AJP - Regu Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Regul Integr Comp Physiol 282: R1164-R1173, 2002; doi:10.1152/ajpregu.00073.2001
0363-6119/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Talon, S.
Right arrow Articles by Léoty, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Talon, S.
Right arrow Articles by Léoty, C.
Vol. 282, Issue 4, R1164-R1173, April 2002

IP3-induced tension and IP3-receptor expression in rat soleus muscle during postnatal development

Sophie Talon1, Olivier Vallot2, Corinne Huchet-Cadiou1, Anne-Marie Lompré2, and Claude Léoty1

1 Laboratoire de Physiologie Générale, Unité Mixte de Recherche 6018 du Centre National de la Recherche Scientifique, Faculté des Sciences et des Techniques, Université de Nantes, F-44322 Nantes, Cedex 03; and 2 Laboratoire des Gènes et des Protéines Musculaires, Ecole Polytechnique, Centre National de la Recherche Scientifique 1088, Université Paris-Sud, 91405 Orsay, Cedex, France


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The present study was designed to examine whether changes in Ca2+ release by inositol-1,4,5-trisphosphate (IP3) in 8-, 15-, and 30-day-old rat skeletal muscles could be associated with the expression of IP3 receptors. Experiments were conducted in slow-twitch muscle in which both IP3-induced Ca2+ release and IP3-receptor (IP3R) expression have been shown to be larger than in fast-twitch muscle. In saponin-skinned fibers, IP3 induced transient contractile responses in which the amplitude was dependent on the Ca2+-loading period with the maximal IP3 contracture being at 20 min of loading. The IP3 tension decreased during postnatal development, was partially inhibited by ryanodine (100 µM), and was blocked by heparin (20-400 µg/ml). Amplification of the DNA sequence encoding for IP3R isoforms (using the RT-PCR technique) showed that in slow-twitch muscle, the type 2 isoform is mainly expressed, and its level decreases during postnatal development in parallel with changes in IP3 responses in immature fibers. IP3-induced Ca2+ release would then have greater participation in excitation-contraction coupling in developing fibers than in mature muscle.

sarcoplasmic reticulum Ca2+ release; inositol-1,4,5-trisphosphate; skinned slow-twitch fibers; mammalian muscles


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

INCREASED INTRACELLULAR CA2+activity is an important factor in the contractile process of skeletal muscle, because Ca2+ binds to contractile proteins and triggers contraction. In adult skeletal muscle, the major pathway for increasing intracellular Ca2+ is the depolarization of transverse tubular system membranes, which induces the release of Ca2+ from the sarcoplasmic reticulum by opening Ca2+ channels/ryanodine receptors (RyR; see Ref. 8). The most accepted hypothesis for the coupling of Ca2+ release and the contractile responses to excitation in skeletal muscle is a direct interaction between the "voltage sensor" dihydropyridine receptor of tubular membranes and the RyR of sarcoplasmic reticulum (15, 35). It has also been suggested that an intracellular messenger, inositol-1,4,5-trisphosphate (IP3), contributes to excitation-contraction coupling in skeletal muscle (44, 45). Such chemical coupling is well established in smooth muscle (2, 39), but its role in skeletal muscle remains controversial. Although Posterino and Lamb (33) found that application of IP3 failed to produce contractile force in fibers in which excitation-contraction coupling was functional, Lopez and Parra (25) have shown that local contraction can be induced by microinjection of IP3 into intact skeletal fibers. Furthermore, recent experiments conducted on skinned skeletal muscle fibers have shown that IP3 induces contractile responses (41, 42), which suggests that IP3 may play a role in excitation-contraction coupling of skeletal muscle.

Although RyR appears to be the major Ca2+ channel of the sarcoplasmic reticulum that is expressed in skeletal muscle (47), a molecular and histochemical study has shown that IP3 receptors (IP3R) are also present in skeletal muscle (30). Rosemblit and colleagues (36) found that IP3R are expressed at comparatively higher levels during early stages of striated muscle development in murine embryos, whereas the IP3R level is much lower after birth and in adults (5, 30). Thus it is possible that the participation of IP3R in excitation-contraction coupling of skeletal muscle is greater during muscular development than at mature stages.

The present study was designed to examine whether IP3-mediated Ca2+ release changes during postnatal development in slow-twitch rat skeletal muscle and whether IP3 contractile responses can be correlated with the level of IP3R expression. Experiments were conducted in saponin-skinned soleus fibers, because IP3-induced Ca2+ release and IP3R expression were found to be larger in this type of muscle than in fast-twitch muscle (30, 41). In addition, molecular techniques were used to investigate the expression of IP3R isoforms in neonatal muscles. The results show that the IP3R are present and functional in immature slow-twitch skeletal fibers, and that IP3-induced Ca2+ release and expression of IP3R are greater in 8-day-old than in 30-day-old rat soleus muscles.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Dissection

All procedures were carried out in accordance with the stipulations of the Helsinki Declaration for the care and use of laboratory animals. Newborn Wistar rats at different stages of postnatal development (7-8 days, 15-20 g; 14-15 days, 50-60 g; and 30 days, 80-100 g) were heavily anesthetized with ether vapor in a bell jar and killed by asphyxia. Soleus muscles were then excised and quickly frozen in liquid nitrogen for total RNA isolation or placed in oxygenated HEPES-buffered physiological solution in a dissecting dish at room temperature for skinning experiments.

The control physiological solution contained (in mM) 140 NaCl, 6 KCl, 3 CaCl2, 2 MgCl2, and 5 HEPES. The pH was adjusted to 7.4 with Tris base.

Chemically Skinned Fiber Preparation

From freshly isolated soleus muscles, short-cut small bundles of 5-10 fibers (1-2 mm in length; 50-100 µm in diameter) were manually dissected with fine scissors and forceps with the aid of a microscope. Chemical skinning was carried out immediately after dissection. The experiments were conducted with fibers that had been skinned using two types of chemical detergents, saponin and Triton X-100.

For Triton X-100-skinned fibers, preparations were incubated for 1 h in a relaxing solution (pCa 9.0) containing 1% (vol/vol) Triton X-100 to solubilize membranes and were then transferred to relaxing solution without detergent. After fibers were skinned, some were stored at -20°C in relaxing solution containing 50% (vol/vol) glycerol. Saponin-induced skinning was performed by incubating the bundles for 30 min in relaxing solution containing 50 µg/ml saponin. This treatment permeabilizes the sarcolemmal and T-tubule membranes and leaves the sarcoplasmic reticulum intact (13). The mechanism of sarcoplasmic reticulum Ca2+ load and release could then be studied on these skinned fibers (14).

After the skinning procedure, fibers were transferred to a chamber and mounted between two stainless-steel tubes fixed to an assembly (21). One end of the fiber bundle was snared in a loop of fine hair pulled into a tube glued to a fixed rod. The other end was similarly snared to a tube glued to a flexible rod that supported a metal target facing the sensor of a displacement-measuring system transducer (KD 2300, 0.5 SU; Kaman, Colorado Springs, CO). The output voltage of the system was proportional to the distance between the sensor face and the target. The diameter and length of the skinned muscle fibers were measured using a binocular microscope. The preparation was adjusted to slack length and then stretched step by step (two or three times) until the tension (mN/mm2) developed at pCa 4.5 became maximal. Maximal tension (Tmax) was generally reached when resting length was increased by 20%. The results were discarded if the decrease in Tmax was >5%. All experiments were performed at 22°C.

Measurement of Ca2+-Activated Tension

For experiments on Triton X-100-skinned fibers, a full set of solutions containing different Ca2+ concentrations ([Ca2+]) was prepared, and the solution at each [Ca2+] was then divided into appropriate aliquots: one served as a control, and the others contained either IP3 (100 µM), ryanodine (100 µM), or heparin (20, 100, or 400 µg/ml). The fiber was exposed sequentially to solutions of decreasing pCa until pCa 4.5, at which Tmax developed, and then the fiber was returned to pCa 9.0. This control cycle was followed by a test cycle performed in the presence of IP3, ryanodine, or heparin. Isometric tension was continuously recorded on chart paper (Linear Bioblock 1200, Reno, NV), and baseline tension was established at the steady state that was measured in the relaxing solution. To obtain the Ca2+-sensitivity curve, data for relative tensions were fitted using a modified Hill equation
Relative tension<IT>=</IT>T<IT>/</IT>T<SUB>max</SUB><IT>=</IT>[Ca<SUP>2+</SUP>]<SUP>n<SUB>H</SUB></SUP><IT>/</IT>(<IT>K</IT><SUP>n<SUB>H</SUB></SUP><IT>+</IT>[Ca<SUP>2+</SUP>]<SUP>n<SUB>H</SUB></SUP>)
The pCa for half-maximal activation (pCa50 = -log10 · K) indicates the apparent Ca2+ sensitivity of contractile proteins, and the Hill coefficient (nH) allows us to estimate the degree of cooperativity. These two parameters were calculated for each experiment using linear regression analysis. The value of nH for each fiber type was calculated as the slope of the fitted straight lines. Resting tension was that in pCa 9.0, and Tmax was obtained in pCa 4.5.

Ca2+ Uptake and Release in Sarcoplasmic Reticulum

For experiments on saponin-skinned fibers, the preparation was immersed sequentially in five different solutions to load the sarcoplasmic reticulum with Ca2+ and then release it with caffeine (10 mM; Table 1). The ionic compositions of these solutions were the same as those of the relaxing and activating solutions (pCa 9.0 and 4.5, respectively). However, the concentrations of EGTA, Mg2+, and Ca2+ differed, as is described here and in Table 1.

                              
View this table:
[in this window]
[in a new window]
  		Table 1.   Experimental conditions of a Ca2+ load-release cycle and test cycles

Solution 1 (pCa 9.0) was a high-EGTA (10 mM), high-Mg2+ (1 mM), high-caffeine (25 mM) solution that was used to deplete the sarcoplasmic reticulum of Ca2+. Solution 2 was a caffeine-free wash solution similar to solution 1. Solution 3 (pCa 7.0) was a high-EGTA (10 mM), high-Mg2+ (1 mM) solution used to load the sarcoplasmic reticulum with Ca2+. Solution 4 (pCa 7.5) was a low-EGTA (0.4 mM), low-Mg2+ (0.1 mM) solution used to prepare Ca2+ release. Solution 5 was similar to solution 4 but contained 10 mM caffeine to release Ca2+ from the sarcoplasmic reticulum. To facilitate the opening of Ca2+-release channels, the Mg2+ concentration ([Mg2+]) was decreased to 0.1 mM in solutions 4 and 5. A caffeine concentration of 10 mM was used, which produced a reduced sensitizing effect on contractile protein (46), whereas it provided a contracture amplitude identical to that obtained at larger caffeine concentrations. During a Ca2+ load-release cycle, the incubation time of skinned fiber was 1 min in solutions 1 and 2 and 2 min in solution 3, whereas solutions 4 and 5 were prolonged to allow recording of the complete transient tension developed by IP3 or caffeine. Caffeine induced a transient contracture for which the area (in mN · mm-2 · min-1), amplitude (in mN/mm2), time to peak (in s), and half-relaxation time (in s) were measured.

At the beginning of each experiment, two or three 10-mM caffeine contractures were generated, and similar challenges were performed regularly. During the experiments, the area, amplitude, time to peak, and half-relaxation time of control caffeine contracture were not significantly modified, which suggests that the sarcoplasmic reticulum remained in a suitable functional state after the saponin skinning. Results were discarded if the decrease in the area of transient tension was >5% at the end of the experiments. IP3 was used at a concentration of 100 µM to produce a marked effect and allow comparison of results with those previously reported for adult rats (41). The experimental protocol consisted of a Ca2+ load-release cycle in which solutions 3 and 4 were followed by a solution containing IP3 (100 µM) but was otherwise identical to solution 4 before the application of caffeine (solution 5). In subsequent experiments, the amplitude of the 10-mM caffeine contracture obtained (in mN/mm2) was expressed as a percentage of Tmax. The difference between the tension achieved in solution 4 in the presence or absence of IP3 corresponded to the IP3 tension and was expressed as a percentage of Tmax. The effects of different loading periods (from 0 to 20 min in solution 3) were tested on the IP3 (100 µM) and caffeine (10 mM) responses. Heparin (20-400 µg/ml) applied for 2 min in solution 3 at the end of loading was also tested on IP3-induced tension.

The effects of ryanodine (100 µM) were tested on the sarcoplasmic reticulum Ca2+ release induced by IP3 or caffeine. Ryanodine activates RyR at a low concentration (<10 µM) but blocks activated RyR at concentrations >10 µM (27). To block RyR, 100 µM of ryanodine were applied after a 20-min loading period during a contracture induced by 20 mM of caffeine (which activated ryanodine-sensitive Ca2+ channels). In the presence of ryanodine, three or four Ca2+ load-release cycles were needed to abolish caffeine contracture completely and allow Ca2+ release to be induced by IP3 (100 µM).

Skinned-Fiber Solutions

The [Ca2+] of relaxing (pCa 9.0, solution A) and activating (pCa 4.5, solution B) skinned-fiber solutions was calculated using the computer program of Godt and Nosek (20). Solutions A and B, at pH 7.10, were calculated to contain 10 mM EGTA, 30 mM imidazole, 30.6 mM Na+, 1 mM Mg2+, 3.16 mM MgATP, 12 mM phosphocreatine, and 0.3 mM dithiothreitol. An ionic strength of 160 mM was achieved by adding KCl.

In saponin-skinned fiber experiments, solutions also contained phosphocreatine kinase (17.5 IU/ml) and sodium azide (1 mM). For Triton X-100- and saponin-skinned fiber experiments, solutions with intermediate [Ca2+] were obtained by mixing relaxing and activating solutions in appropriate proportions. EGTA, phosphocreatine, heparin (low mol wt, 6,000 g/mol), and ryanodine were obtained from Sigma (St. Louis, MO), and IP3 was obtained from Calbiochem. IP3, heparin, and ryanodine were prepared as stock solutions (20, 16.6, and 5 mM, respectively) in deionized and distilled water.

Statistical Analysis

All values are expressed as means ± SE. Student's unpaired t-test was used to compare the different parameters when groups were different. However, when experiments were performed on the same fiber, Student's paired t-test was used (as specified in the text). Statistical significance was reached when P < 0.05.

Total RNA Isolation

Skeletal tissues were homogenized at 4°C with RNA Insta-Pure (1-2 ml/50-100 mg of tissue; Eurogentec) with a few strokes in an Ultrarax homogenizer. Tissues were pooled from 6-9 rats for 1-, 7-8-, and 14-15-day-old animals. RNA was extracted using the protocol provided by the company. At the end of the procedure, the RNA pellet was dissolved in 100 µl of sterile water and was used immediately or stored in ethanol at -20°C.

RT-PCR Analysis

The procedures used for RT and PCR analysis in the present study were previously described by Perez and colleagues (32). Total RNA (1 µg) from rat skeletal muscle samples was used as a template for first-strand cDNA synthesis. Each 20-µl reaction contained 1 mM dNTPs (Promega), 40 U of RNase inhibitor (Promega), 50 pmol of random primers in 10 mM Tris · HCl (pH 8.3), 50 mM KCl, 5 mM MgCl2, and 50 U of murine leukemia virus reverse transcriptase (PerkinElmer). Reactions were incubated at room temperature for 10 min and then at 42°C for 40 min before being heat-inactivated for 5 min at 99°C.

Skeletal muscle cDNAs were used as templates for amplification of DNA sequences encoding both the IP3R and the RyR. For IP3R and RyR amplification, 18 and 2 µl, respectively, of cDNA were used in final volumes of 100 and 50 µl, respectively. The PCR reaction contained 200 µM dNTPs, 50 pmol each of sense and antisense oligonucleotides, 10 mM Tris · HCl (pH 8.3), 50 mM KCl, 1 mM MgCl2, and 2.5 U of AmpliTaq DNA polymerase (PerkinElmer). Control templates for types 1, 2, and 3 IP3R were from brain, heart, and colon carcinoma cells (Caco cells), respectively. The 5' and 3' oligonucleotide primers common to all receptor types used in the PCR assays were AGCAAGCTTGGCTCTTATCCTGGTTTACCTGTTCTC and GTCAAGCTTGTCCCTTTCCAAGCCGCAGATGAAGCA, respectively. Reaction conditions consisted of 1 cycle at 95°C for 2 min; 40 cycles at 95°C for 20 s, 60°C for 30 s, and 72°C for 30 s; and 1 cycle at 72°C for 7 min. The 5' and 3' primers to the type 1 RyR used in the PCR assays were GTTCTAGAGAAGGTTCTGGACAAAACAC and CCAAGCTTTCGCTCTTGTTGTAGAATTT, respectively. Reaction conditions consisted of 1 cycle at 95°C for 2 min; 28 cycles at 95°C for 20 s, 52°C for 30 s, and 72°C for 30 s; and 1 cycle at 72°C for 7 min.

Southern Blotting and Hybridization

PCR products derived from rat skeletal muscle total RNA primed with RyR oligonucleotides and IP3R consensus oligonucleotides were resolved on 8% acrylamide gels. RyR product was visualized using Vistra Green. The IP3R products were loaded on three gels and blotted onto individual nylon membranes. Blots were hybridized to receptor type-specific 32P-labeled oligonucleotides and washed at high stringency in solutions containing a saline sodium citrate buffer (SSC, 10×) and sodium dodecyl sulfate (SDS, 20%). All membranes were washed for 5 min in a SSC (6×)-SDS (0.5%) solution at room temperature. The membranes were then washed for 1 h in a SSC (2×)-SDS (0.1%) solution at 50°C for types 1 and 2 and at 40°C for type 3. The last washing of membranes was performed for 2 h in SSC (0.5×)-SDS (0.1%) solution at 50°C for types 1 and 2 and at 40°C for type 3. The receptor type-specific oligonucleotides were as follows: type 1, CGCATCGATGGTCTTGTTGGCCTCTTTGGATGGCTTCCT; type 2, CCTCCCTCACCGGCTGCATTCGAAGA; and type 3, AGGGCTTGCTTAGAATGTCGC.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Changes in Maximal Ca2+-Activated Tension and IP3 Contractile Responses During Postnatal Development

In saponin-induced skinning experiments, immature slow-twitch fibers were loaded for different periods (2, 5, 10, and 20 min) with Ca2+ (pCa 7.0, solution 3). After a given loading period, fibers were bathed in a solution at pCa 7.5, and an application of an identical solution with or without IP3 (100 µM) was subsequently applied. Caffeine (10 mM) was then applied to release Ca2+ from the sarcoplasmic reticulum, which resulted in transient contracture (see Table 1). Caffeine contracture amplitude was used as an index of sarcoplasmic reticulum Ca2+ content to ensure the integrity of the sarcoplasmic reticulum.

A series of measurements was first made to estimate the maximal Ca2+-activated tension (Tmax) of newborn rat slow-twitch fibers. Results showed the amplitude of Tmax increased significantly during development [61.5 ± 2.7 mN/mm2 (n = 14), 86.3 ± 2.7 mN/mm2 (n = 12; P < 0.01), and 120.3 ± 7.4 mN/mm2 (n = 11; P < 0.001) in 8-, 15-, and 30-day-old rat muscles, respectively].

Figure1 illustrates the effects of a solution at pCa 7.5 (0.1 mM Mg2+) with (B) or without (A) 100 µM IP3 on the tension achieved at pCa 7.5 (0.1 mM Mg2+) in newborn rats. Figure 1B shows that after 20 min of loading in solution 3, IP3 (100 µM) applied after the tension produced at pCa 7.5 in solution 4 had reached a steady level resulted in transient tension. IP3-induced tension decreased during postnatal development (Fig. 1B). No increase in tension was observed in the absence of IP3 (Fig. 1A); however, the tension achieved at pCa 7.5 in the absence of IP3 (Fig. 1, A and B) increased with postnatal development. For example, after 20 min of loading, the amplitude of this tension was 2.1 ± 0.4 mN/mm2 (n = 14), 3.7 ± 0.7 mN/mm2 (n = 21), and 7.6 ± 1.7 mN/mm2 (n = 19; P < 0.01) in fibers from 8-, 15-, and 30-day-old rats, respectively.


View larger version (13K):
[in this window]
[in a new window]
  		Fig. 1.   Effects of inositol-1,4,5-trisphosphate (IP3) on Ca2+ release from the sarcoplasmic reticulum in slow-twitch saponin-skinned fibers from 8-, 15-, and 30-day-old rats. Traces show records of tension developed at pCa 7.5 (0.1 Mg2+, solution 4) in the absence (A) or presence (B) of IP3 (100 µM) after 20 min of loading. Solution 4 was applied (arrows) until tension reached a steady level; fiber was then bathed in solution 4 (horizontal bars). Composition of each solution is given in the text (see MATERIALS AND METHODS) and Table 1. InsP3, IP3.

To compare the IP3 responses obtained between immature fibers, the IP3-induced enhancements in tension achieved at pCa 7.5 were expressed as a percentage of Tmax for each stage of postnatal development. Figure 2 illustrates the changes in IP3 tension for different loading periods in 8-, 15-, and 30-day-old rat soleus muscle fibers. The results show that a 2-min loading period was sufficient to produce significant IP3 response in immature fibers (Fig. 2). The peak tension induced by IP3 at 2 min was not significantly different in neonatal muscles at 8, 15, and 30 days of development [0.94 ± 0.13% (n = 14), 1.11 ± 0.16% (n = 12), and 0.87 ± 0.11% of Tmax (n = 11), respectively]. For 5 and 10 min of loading, the amplitude of the IP3 response was similar in fibers from 8- and 15-day-old rat muscles, but greater than that obtained at 30 days of development. For example, the peak tension induced by IP3 after 10 min of loading was 1.90 ± 0.3% (n = 8), 1.93 ± 0.54% (n = 7), and 1.26 ± 0.54% of Tmax (n = 8), respectively, 8, 15, and 30 days after birth. At 20 min, fibers from 8- and 15-day-old rat soleus muscle developed a similar IP3 tension that was greater than that obtained in fibers from 30-day-old animals (Table 2).


View larger version (18K):
[in this window]
[in a new window]
  		Fig. 2.   Dependence of IP3 contracture amplitude on the loading period in slow-twitch saponin-skinned fibers from newborn rats. Results were obtained on fibers of soleus muscle at 8 (), 15 (black-down-triangle ), and 30 () days of postnatal development. IP3 (100 µM) was applied after the loading period in solution 4 (pCa 7.5, 0.1 mM Mg2+). Amplitude of IP3 contracture is expressed as a percentage of maximal tension (Tmax). InsP3, IP3.


                              
View this table:
[in this window]
[in a new window]
  		Table 2.   Caffeine contracture, IP3 tension, and effects of ryanodine and heparin on IP3 tension in slow-twitch skinned fibers from rats

Regarding the 10-mM caffeine-induced contractile responses obtained in skeletal fibers of newborn rats, the contracture amplitude, when expressed as a percentage of Tmax amplitude at each stage of development, was not significantly different between the immature slow-twitch muscles (Table 2). Furthermore, the increase in the loading period from 2 to 20 min induced no significant variations in the amplitude of caffeine contracture at each stage of postnatal development tested. The maximal response induced by caffeine was obtained at 2 min of loading, whereas 20 min were required to reach the maximum of IP3 tension.

The IP3 tension observed in the present study could have been related to Ca2+ release from sarcoplasmic reticulum or an increase in the Ca2+ sensitivity of the contractile apparatus. To investigate the latter possibility, the effects of IP3 were estimated on maximal Ca2+-activated tension and the apparent Ca2+ sensitivity of contractile proteins in Triton X-100-skinned fibers from newborn rats.

Effects of IP3 on Ca2+-Activated Tension on Immature Triton X-100-Skinned Fibers

The results obtained showed that the tension developed by the contractile apparatus when maximally activated by Ca2+ (pCa 4.5) was not affected by IP3 (100 µM) at each stage of postnatal development tested. Moreover, no significant differences in apparent Ca2+ sensitivity were observed between the relative tension-pCa curves recorded in the absence or presence of IP3 (100 µM). Thus in immature fibers, IP3 failed to affect pCa50 (the amount of Ca2+ required to produce 50% of Tmax). For example, pCa50 in the absence or presence of IP3 (100 µM) was 6.41 ± 0.03 versus 6.42 ± 0.03 (n = 3), 6.45 ± 0.03 versus 6.47 ± 0.02 (n = 3), and 6.47 ± 0.03 versus 6.45 ± 0.02 (n = 3), respectively, in 8-, 15-, and 30-day-old rat soleus fibers.

Thus the IP3 tension previously observed in saponin-skinned preparations could have been related to an effect of IP3 on Ca2+ release from the sarcoplasmic reticulum. Accordingly, the effects of ryanodine and heparin (inhibitors of RyR and IP3R, respectively) were tested on IP3-induced contractile responses.

Effects of Ryanodine on IP3 Tension

Ryanodine experiments were performed as previously described in adult muscle (41). Briefly, after a 20-min loading time, 100 µM ryanodine was applied during a caffeine contracture (caffeine activates ryanodine-sensitive Ca2+ channels). The transient caffeine contractures in the presence of ryanodine were irreversibly abolished after three or four Ca2+ load-release cycles, which suggests that all caffeine-sensitive Ca2+-release sites were blocked by ryanodine in immature fibers. After fibers were loaded for 20 min, IP3 (100 µM) was applied in solution at pCa 7.5 (solution 4; see Table 1). The results showed that application of IP3 after ryanodine treatment can induce an increase in the tension achieved at pCa 7.5 in immature fibers. The IP3 tension generated by immature fibers 8, 15, and 30 days after birth was significantly decreased in the presence of ryanodine by 65.9 ± 8.1% (n = 3), 51.1 ± 11.8% (n = 4), and 47.9 ± 9.1% (n = 4), respectively (see Table 2). It is noteworthy that the tension obtained at pCa 7.5 in the absence of IP3 was also reduced by ryanodine [33.3 ± 1.5% (n = 3), 73.0 ± 1.0% (n = 4), and 64.1 ± 4.0% (n = 4) in 8-, 15-, and 30-day-old rat muscle fibers, respectively].

Because the ryanodine-induced decrease in IP3 tension could have been related to the action of this inhibitor on contractile proteins, the effects of ryanodine were investigated in Triton X-100-skinned slow-twitch fibers from newborn rats. No significant changes in Tmax and apparent Ca2+ sensitivity were found at any stage of development in the presence of ryanodine (100 µM). For example, in the absence or presence of ryanodine, pCa50 was 6.49 ± 0.02 versus 6.46 ± 0.02 (n = 3), 6.48 ± 0.02 versus 6.49 ± 0.04 (n = 3), and 6.47 ± 0.04 versus 6.44 ± 0.01 (n = 3), respectively, in 8-, 15-, and 30-day-old rat slow-twitch preparations. These results suggest that the ryanodine-induced decrease in IP3 tension observed in immature saponin-skinned fibers was related to the inhibition of IP3-induced Ca2+ release by ryanodine.

Effects of Heparin on IP3 Tension

At 20 µg/ml, heparin decreased IP3 tension by 59.9 ± 6.0% (n = 3) and 35.3 ± 10.1% (n = 3) in 8- and 15-day-old rat slow-twitch fibers, respectively, whereas no changes were observed in fibers from 30-day-old animals (see Table 2). The application of higher concentrations of heparin (100 and 400 µg/ml) induced larger reductions in IP3 tension at each stage of development (see Table 2). For example, at 400 µg/ml, heparin-induced inhibition of IP3 tension was almost maximal in immature fibers [87.9 ± 1.8% (n = 3), 85.0 ± 15.0% (n = 3), and 92.5 ± 7.5% (n = 3) from soleus muscles in 8-, 15-, and 30-day-old rats, respectively; see Table 2]. It is noteworthy that the effects of heparin were not fully reversible. For example, in soleus muscles of 8- and 15-day-old rats, after application of 100 µg/ml of heparin and a return to control conditions for 20 min, IP3 tension was still reduced by 39.3 ± 6.4% (n = 3) and 17.5 ± 2.5% (n = 3), respectively (see Table 2).

Because the heparin-induced decrease in IP3 tension could have been related to an effect on the contractile apparatus, Tmax and the apparent Ca2+ sensitivity of contractile proteins were estimated in the absence or presence of 20, 100, or 400 µg/ml of heparin in immature Triton X-100-skinned fibers. At each tested stage of development, Tmax was not affected by 20 µg/ml of heparin. However, heparin at a concentration of 100 µg/ml reduced Tmax by 6.3 ± 0.5% (n = 3), 15.0 ± 1.4% (n = 3), and 10.2 ± 8.2% (n = 3) in 8-, 15-, and 30-day-old rat fibers, respectively. This effect on Tmax was more pronounced when a larger concentration of heparin was used. For example, at 400 µg/ml, Tmax was decreased by 29.4 ± 12.1% (n = 3), 30.2 ± 3.1% (n = 3), and 21.1 ± 0.7% (n = 3) at 8, 15, and 30 days after birth, respectively. At each stage of postnatal development, 20 and 100 µg/ml of heparin induced no significant changes in relative tension-pCa relationships, which indicates that apparent Ca2+ sensitivity was unaffected by low concentrations of heparin in immature fibers. However, heparin at 400 µg/ml induced a shift to the right in relative tension-pCa curves (Fig. 3), thereby reducing pCa50 below the control value (Delta pCa50): -0.05 ± 0.01 (n = 3; P < 0.05), -0.06 ± 0.01 (n = 3; P < 0.05), and -0.08 ± 0.01 (n = 3; P < 0.05) from soleus muscles in 8-, 15-, and 30-day-old rats, respectively.


View larger version (11K):
[in this window]
[in a new window]
  		Fig. 3.   Effects of heparin (400 µg/ml) on the myofibrillar Ca2+ sensitivity of Triton X-100-skinned fibers from soleus muscles in 8-, 15- and 30-day-old rats. Isometric relative tension-pCa relationships were obtained in the absence (open circle ) or presence () of 400 µg/ml heparin. Force is expressed as a percentage of Tmax at pCa 4.5. Curves were fitted using the modified Hill equation. Experiments were carried out at 22°C.

Taken together, the present results indicate that the heparin-induced decrease in IP3 tension in saponin-skinned immature fibers was mainly related to an inhibition of IP3-induced Ca2+ release. This suggests that IP3R were present and functional in immature skeletal muscle. To complete the results obtained with Ca2+ release inhibitors, a molecular technique (RT-PCR) was used to investigate the presence of IP3R.

Analysis of IP3R Expression

To determine the expression pattern of IP3R mRNA in skeletal muscle, RT-PCR was performed on total RNA from slow-twitch muscles isolated from rats at different stages of postnatal development. Primers common to all three types of IP3R cDNA sequences were used, and IP3-specific isoforms were detected by Southern blotting using specific internal primers. The results (Fig. 4, middle) show that type 2 receptor isoform transcript was the predominant IP3R expressed in adult and developing skeletal muscle and that the expression of this isoform decreased during postnatal development in skeletal muscle. Type 2 IP3R (IP3R2) was highly expressed in brain and heart. Furthermore, type 1 isoform (IP3R1), mainly present in brain, was also amplified in skeletal muscle during the first stages of development (Fig. 4, top). It is noteworthy that type 3 IP3R (IP3R3) was not detected in skeletal muscle regardless of the stage of development studied (data not shown).


View larger version (76K):
[in this window]
[in a new window]
  		Fig. 4.   Expression of IP3 receptor (IP3R) mRNA during the postnatal development of slow-twitch muscle. Analysis of type 1 and type 2 IP3 receptor (IP3R-I and IP3R-II, respectively) mRNA expression and type 1 ryanodine receptor (RyR1) mRNA expression in slow-twitch skeletal muscle from adult and 8-, 15-, and 30-day-old rats as determined by PCR assay. Sequences common to all three receptor types were used as primers in the PCR amplification of IP3R. Total mRNAs from brain and heart were used as positive controls for IP3R-I and IP3R-II, respectively. The same RNAs without reverse transcriptase were used as negative controls (not shown). PCR products were resolved on 8% acrylamide gels, blotted, and hybridized with receptor type-specific 32P-labeled oligonucleotide probes internal to the PCR primer pair. Blots were exposed to the phosphorscreen for 3 days and scanned on a Storm (Molecular Dynamics). Primers used for the amplification of ryanodine receptor corresponded to the sequence-specific RyR1. PCR products were resolved on 8% acrylamide gels and revealed with Vistra Green.

Compared with IP3R mRNA, type 1 RyR (RyR1) mRNA was highly present at each stage of postnatal development, but was not expressed in brain and heart (Fig. 4, bottom).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

This study shows that in newborn slow-twitch fibers, a tension is produced by the application of IP3, an activator of IP3R. The results obtained from Triton X-100-skinning experiments indicate that contractile responses are not related to an IP3-induced increase in the Ca2+ sensitivity of the contractile apparatus. It could be proposed that the IP3 contractures observed in immature skeletal muscle fibers were due to the release of Ca2+ from the sarcoplasmic reticulum through IP3R. This hypothesis is supported by experiments in saponin-skinned fibers where it was found that heparin, a specific inhibitor of IP3R, blocks IP3-induced contractile responses. Furthermore, the IP3 contractures could also be generated in the presence of ryanodine, a specific inhibitor of RyR. Taken together, these results suggest that in immature slow-twitch fibers, IP3 induces Ca2+ release from the sarcoplasmic reticulum and probably through IP3R. The results presently found are similar to those previously obtained in adult skeletal muscle showing that IP3R were present and functional in soleus fibers (41, 42). Then, the Ca2+ release from the sarcoplasmic reticulum in mammalian skeletal muscle could be elicited through two types of receptors: one sensitive to IP3 and heparin and the other to caffeine and ryanodine.

The IP3R (a tetramer with a molecular mass of congruent 1.2 million Da) is a ligand-activated channel that requires IP3 to function (12). Three forms of IP3R have been identified. IP3R1, which is expressed in various tissues such as smooth muscle or brain, has been extensively characterized (28). IP3R2 and IP3R3 isoforms share 69 and 64% identity, respectively, with the amino acid sequence of IP3R1. IP3R3 is predominant in non-neural tissues (4), whereas IP3R2 is the main isoform expressed in cardiomyocytes (24, 32). Most tissues express at least two subtypes although in varying ratios (43). The expression of IP3R subtypes could be altered in particular circumstances such as during differentiation in some cell types, which suggests an involvement in cell development (18, 40). In our study, IP3R2 was the main form found in all skeletal muscle samples tested, a result that is similar to those previously reported by De Smedt and colleagues (10) but different from those of Moschella and co-workers (30). Furthermore, our results show that the expression of this isoform decreases during postnatal development (see Fig. 4, middle) in parallel with changes in IP3 tensions in immature saponin-skinned fibers. De Smedt and colleagues (10) have found that a type 2 isoform persisted in adult muscle, whereas the expression of IP3R2 in slow-twitch muscle was below the detection level in our study. Futatsugi and colleagues (19) detected a novel isoform of IP3R2 specifically expressed in skeletal muscle and suggested that the protein encoded by this isoform could be involved in the regulation of IP3-mediated Ca2+ release in skeletal muscle. It is still unclear whether this protein is present in immature fibers. Rosemblit and colleagues (36) showed that high levels of the type 1 isoform are expressed during embryogenesis. Our results indicate that IP3R1 mRNA is present at 8 days and decreases during the postnatal period. IP3R3 was not detected regardless of the postnatal stages studied, whereas De Smedt and colleagues (10, 11) found high levels of this isoform in undifferentiated mouse skeletal muscle cell lines, which were decreased when the cells were induced to differentiate. These differences could be due to the type of preparation and/or to the animal species used and/or to a different sensitivity in the technique used, particularly in the oligonucleotide primer sequences.

Although IP3R are present and their expression is associated with IP3-induced contractile responses, IP3 contractures are small compared with the responses due to caffeine. This raises the question about the role of IP3R in skeletal muscle. Recently, Lipp and co-workers (24) have shown that in cardiomyocytes, IP3R are colocalized with junctional RyR in the subsarcolemmal space and could modulate excitation-contraction coupling. Indeed, their IP3 ester-induced activation provokes spontaneous Ca2+ release and increases the frequency of Ca2+ sparks. Such Ca2+ sparks, which are also present in skeletal muscle, could be involved in an amplification mechanism of Ca2+ release initially induced by "voltage sensor" during membrane depolarization (7, 31). Thus it could be imagined that as in cardiac myocytes, the IP3R could participate in excitation-contraction of skeletal muscle by increasing the small subcellular Ca2+ release evoked by RyR. Such a possibility could then explain the decrease in IP3 contractile responses presently observed in the presence of ryanodine (see Table 2).

At birth, mammalian skeletal muscle cells are not fully differentiated. During embryonic and postnatal development, important changes occur in enzyme activities, innervation patterns, and membrane systems that could account for changes in mechanisms involved in contraction. These modifications correspond to the gradual formation of T tubules and the sarcoplasmic reticulum and to the establishment of an adult-specific protein pattern (16, 37). The contractile properties of skeletal muscle depend mainly on the expression of fiber-type protein isoforms constituting thin and thick filaments (myosin, troponin, and tropomyosin). The synthesis of slow myosin, the major component of thick filaments in slow-twitch fibers, is an early event in skeletal myogenesis. D'Albis and co-workers (9) have shown that the level of this isoform increases continuously in soleus muscle from 40% of total myosin a few days after birth to 80% at 1 mo of age. Adams and colleagues (1) have shown that soleus muscle at birth contains mainly a mixture of embryonic and neonatal myosin heavy chain (MHC) isoforms, which are rapidly repressed and progressively replaced by adult isoform during postnatal development. In skeletal muscle, the adult MHC phenotype is reached in the first 4 wk after birth (1). More recently, Krishan and colleagues (23) have shown that the slow troponin T, a regulatory protein of contractile apparatus, is highly expressed in all embryonic muscle masses, whereas in late development stages its expression is restricted to the slow-twitch fibers. Thus in the present study, the increase in Tmax observed during the postnatal development could also be related to higher levels of contractile protein expression as well as to a transition from an immature to an adult protein pattern, particularly in the MHC and troponin phenotypes.

Previous investigations have shown that the mechanical activity (by interfering with excitation-contraction coupling) could delay the muscle development. In the poorly developed sarcoplasmic reticulum from immature skeletal muscles, the Ca2+ storage capacity as well as the calsequestrin content is low (17). Furthermore, it is important for correct function of the adult muscle that protein-protein interactions become more and more complex during development (17). A tight correlation between the mechanical factors and the organization of myofibrillar protein subunits into sarcomeres has been previously established, and some of the processes involved at the myofibrillar level are Ca2+ dependent (6). The expression and the participation of the IP3R in Ca2+ homeostasis could represent an additional mechanism to release Ca2+ and favor the development of mechanical activity. Then the IP3R could have a role comparable to that of RyR type 3 (RyR3) that was previously shown to be required for an efficient contraction in neonatal skeletal muscles (3). It could be proposed that IP3R as RyR3 could contribute to a secondary component of excitation-contraction coupling which creates an amplification mechanism for regulation of skeletal muscle contraction through a "Ca2+-induced Ca2+-release" mechanism, the latter being particularly important in neonatal muscles where the development of the triad structure is not complete (3, 16).

In summary, the present work clearly shows that the application of IP3 to skeletal muscle induced contractile responses related to Ca2+ release from the sarcoplasmic reticulum. The complementary use of pharmacological tools (ryanodine and heparin) and molecular techniques indicated that IP3R are present and functional in slow-twitch muscle and that the changes in expression during postnatal development were associated with those observed in IP3 tension. Taken together, these results suggest a larger participation of IP3 in excitation-contraction coupling in developing slow-twitch skeletal muscle than in mature muscle.

Perspectives

Although the physiological function of IP3R in skeletal muscle remains unclear, changes in the IP3R pattern occurring in immature skeletal muscle could be involved in the maintenance and/or the control of Ca2+ homeostasis during normal muscle development. Besides, in brain and heart, a dysfunction of IP3R and/or of IP3-induced Ca2+ release contributes to the pathogenesis of Alzheimer's disease and arrhythmia, both disorders being characterized by alterations of Ca2+ homeostasis (29, 38). Abnormalities in Ca2+ homeostasis also occur in various pathological conditions of skeletal muscle. For example, the resting intracellular [Ca2+] is increased in soleus muscle after hindlimb unloading and reloading (22). It was also proposed that Ca2+ homeostasis alterations would be involved in the processes of cell death in Duchenne muscular dystrophy (26). Therefore, some investigations of the effects of IP3 in pathological skeletal muscle would be helpful toward clarifying and improving our understanding of the role of this intracellular messenger in skeletal muscle. Furthermore, as previously reported with RyR3 (3), knockout mice may represent an interesting animal model for further studying the role of IP3R in skeletal muscle.


    ACKNOWLEDGEMENTS

The authors are grateful to the Foundation Langlois and the Centre National d'Études Spatiales (793/99/CNES/7659) for funding this study, which was performed as part of the PhD requirement of S. Talon.


    FOOTNOTES

Address for reprint requests and other correspondence: C. Léoty, Laboratoire de Physiologie Générale, UMR CNRS 6018, Faculté des Sciences et des Techniques, Université de Nantes, 2 rue de la Houssinière, BP 92208, F-44322 Nantes, Cedex 03, France (E-mail: claude.leoty{at}svt.univ-nantes.fr).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

10.1152/ajpregu.00073.2001

Received 8 February 2001; accepted in final form 13 November 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Adams, GR, McCue SA, Zeng M, and Baldwin KM. Time course of myosin heavy chain transitions in neonatal rats: importance of innervation and thyroid state. Am J Physiol Regulatory Integrative Comp Physiol 276: R954-R961, 1999[Abstract/Free Full Text].

2.   Berridge, MJ. Inositol trisphosphate and calcium signaling. Nature 361: 315-325, 1993[Medline].

3.   Bertocchini, F, Ovitt CE, Conti A, Barone V, Scholer HR, Bottineli R, Reggiani C, and Sorrentino V. Requirement for the ryanodine receotor type 3 for efficient contraction in neonatal skeletal muscles. EMBO J 16: 6956-6963, 1997[ISI][Medline].

4.   Blondel, O, Takeda J, Janssen H, Seino S, and Bell GI. Sequence and functional characterization of a third inositol trisphosphate receptor subtype, IP3R-3, expressed in pancreatic islets, kidney, gastrointestinal tract, and other tissues. J Biol Chem 268: 11356-11363, 1993[Abstract/Free Full Text].

5.   Brillantes, AM, Bezprozvannaya S, and Marks AP. Developmental and tissue-specific regulation of rabbit skeletal and cardiac muscle calcium channels involved in excitation-contraction coupling. Circ Res 75: 503-510, 1994[Abstract/Free Full Text].

6.   Byron, KL, Puglisi JL, Holda JR, Eble D, and Samarel AM. Myosin heavy chain turnover in cultured neonatal rat heart cells: effects of [Ca2+] and contractile activity. Am J Physiol Cell Physiol 271: C1447-C1456, 1996.

7.   Conklin, MW, Ahern CA, Vallejo P, Sorrentino V, Takeshima H, and Coronado R. Comparison of Ca2+ sparks produced independently by two ryanodine receptor isoforms (type 1 or type 3). Biophys J 78: 1777-1785, 2000[Abstract/Free Full Text].

8.   Costantin, LL. Contractile activation in skeletal muscle. Prog Biophys Mol Biol 29: 197-224, 1975[Medline].

9.   D'Albis, A, Couteaux R, Janmot C, and Roulet A. Specific programs of myosin expression in the postnatal development of rat muscles. Eur J Biochem 183: 583-590, 1989[ISI][Medline].

10.   De Smedt, H, Missiaen L, Parys JB, Henning RH, Sienaert I, Vanlingen S, Gijsens A, Himpens B, and Casteels R. Isoform diversity of the inositol trisphosphate receptor in cell types of mouse origin. Biochem J 322: 575-583, 1997.

11.   De Smedt, H, Parys JB, Himpens B, Missiaen L, and Borghgraef R. Changes in the mechanism of Ca2+ mobilization during the differentiation of BC3H1 muscle cells. Biochem J 273: 219-224, 1991.

12.   Ehrlich, BE. Functional properties of intracellular calcium-release channels. Curr Opin Neurobiol 5: 304-309, 1995[ISI][Medline].

13.   Endo, M, and Iino M. Specific perforation of muscle cell membranes with preserved SR functions by saponin treatment. J Muscle Res Cell Motil 1: 89-100, 1980[Medline].

14.   Fano, G, Bella S, Fulle S, Angelella P, Panara F, Marsili V, and Pascolini R. Functional aspects of calcium transport in sarcoplasmic reticulum vesicles derived from frog skeletal muscle treated by saponin. J Muscle Res Cell Motil 10: 326-330, 1989[ISI][Medline].

15.   Fleischer, S, and Inui M . Biochemistry and biophysics of excitation-contraction coupling. Ann Rev Biophysic Biophys Chem 18: 333-364, 1989[ISI][Medline].

16.   Flucher, BE, and Franzini-Armstrong C. Formation of junctions involved in excitation-contraction coupling in skeletal and cardiac muscle. Proc Natl Acad Sci USA 93: 8101-8106, 1996[Abstract/Free Full Text].

17.   Froemming, GR, and Ohlendieck K. Oligomerisation of Ca2+-regulatory membrane components involved in the excitation-contraction-relaxation cycle during postnatal development of rabbit skeletal muscle. Biochim Biophys Acta 1387: 226-238, 1998[Medline].

18.   Furuichi, T, Shiota C, and Mikoshiba K. Distribution of inositol 1,4,5-trisphosphate receptor mRNA in mouse tissues. FEBS Lett 267: 85-88, 1990[ISI][Medline].

19.   Futatsugi, A, Kuwajima G, and Mikoshiba K. Muscle-specific mRNA isoform encodes a protein composed mainly of N-terminal 175 residues of type 2 Ins(1,4,5)P3 receptor. Biochem J 334: 559-563, 1998.

20.   Godt, RE, and Nosek TM. Changes in intracellular milieu with fatigue or hypoxia depress contraction of skinned rabbit skeletal and cardiac muscle. J Physiol (Lond) 412: 155-180, 1989[Abstract/Free Full Text].

21.   Huchet, C, and Léoty C. Effects of cyclopiazonic acid on Ca2+-activated tension production in skinned skeletal muscle fibers of the ferret. Eur J Pharmacol 241: 41-46, 1993[ISI][Medline].

22.   Ingalls, CP, Warren GL, and Armstrong RB. Intracellular Ca2+ transients in mouse soleus muscle after hindlimb unloading and reloading. J Appl Physiol 87: 386-390, 1999[Abstract/Free Full Text].

23.   Krishan, K, Morgan MJ, Zhao W, and Dhoot GK. Slow troponin T mRNA in striated muscles is expressed in both cell type and developmental stage specific manner. J Muscle Res Cell Motil 21: 527-536, 2000[ISI][Medline].

24.   Lipp, P, Laine M, Tovey SC, Burrell KM, Berridge MJ, Li W, and Bootman MD. Functional InsP3 receptors that may modulate excitation-contraction coupling in heart. Curr Biol 10: 939-942, 2000[ISI][Medline].

25.   Lopez, JR, and Parra L. Inositol 1,4,5-trisphosphate increases myoplasmic [Ca2+] in isolated muscle fibers. Depolarization enhances its effects. Cell Calcium 12: 543-557, 1991[ISI][Medline].

26.   Marchand, E, Constantin B, Vandebrouck C, Raymond G, and Cognard C. Calcium homeostasis and cell death in Sol8 dystrophin-deficient cell line in culture. Cell Calcium 29: 85-96, 2001[ISI][Medline].

27.   Meissner, G. Ryanodine activation and inhibition of the Ca2+ release channel of sarcoplasmic reticulum. J Biol Chem 261: 6300-6306, 1986[Abstract/Free Full Text].

28.   Mikoshiba, K, Furuichi T, Maeda N, Yoshikawa S, Miyawaki A, Niinobe M, and Wada K. Primary structure and functional expression of the inositol 1,4,5-trisphosphate receptor, P400. Adv Exp Med Biol 287: 83-95, 1991[Medline].

29.   Missiaen, L, Robberecht W, van den Bosch L, Callewaert G, Parys JB, Wuytack F, Raeymaekers L, Nilius B, Eggermont J, and De Smedt H. Abnormal intracellular Ca2+ homeostasis and disease. Cell Calcium 28: 1-21, 2000[ISI][Medline].

30.   Moschella, MC, Watras J, Jayaraman T, and Marks AR. Inositol 1,4,5-trisphosphate receptor in skeletal muscle: differential expression in myofibers. J Muscle Res Cell Motil 16: 390-400, 1995[ISI][Medline].

31.   Niggli, E. Localized intracellular calcium signaling in muscle: calcium sparks and calcium quarks. Annu Rev Physiol 61: 311-335, 1999[ISI][Medline].

32.   Perez, PJ, Ramos-Franco J, Fill M, and Mignery GA. Identification and functional reconstitution of the type 2 inositol 1,4,5-trisphosphate receptor from ventricular cardiac myocytes. J Biol Chem 272: 23961-23969, 1997[Abstract/Free Full Text].

33.   Posterino, GS, and Lamb GD. Investigation of the effect of inositol trisphosphate in skinned skeletal muscle fibers with functional excitation-contraction coupling. J Muscle Res Cell Motil 19: 67-74, 1998[ISI][Medline].

34.   Putney, JW. Capacitive Calcium Entry. Austin, TX: Landes, 1997.

35.   Rios, E, and Pizzaro G. Voltage sensor of excitation-contraction coupling in skeletal muscle. Physiol Rev 71: 849-908, 1991[Free Full Text].

36.   Rosemblit, N, Moschella MC, Ondriasova E, Gutstein DE, Ondrias K, and Marks AR. Intracellular calcium release channel expression during embryogenesis. Dev Biol 206: 163-177, 1999[ISI][Medline].

37.   Schiaffino, S, and Reggiani C. Molecular diversity of myofibrillar proteins: gene regulation and functional significance. Physiol Rev 76: 371-423, 1996[Abstract/Free Full Text].

38.   Shilkrut, M, Gealekman O, Rosen D, Berke G, Woodcock E, and Binah O. Electrophysiologic perturbations and arrhythmogenic activity caused by activation of the Fas receptor in murine ventricular myocytes: role of the inositol trisphosphate pathway. J Cardiovasc Electrophysiol 12: 185-195, 2001[ISI][Medline].

39.   Somlyo, AV, Bond M, Somlyo AP, and Scarpa A. Inositol trisphosphate-induced calcium release and contraction in vascular smooth muscle. Proc Natl Acad Sci USA 82: 5231-5235, 1985[Abstract/Free Full Text].

40.   Sugiyama, T, Yamamoto-Hino M, Miyawaki A, Furuichi T, Mikoshiba K, and Hasegawa M. Subtypes of inositol 1,4,5-trisphosphate receptor in human hematopoeitic cell lines: dynamic aspects of their cell-type specific expression. FEBS Lett 349: 191-196, 1994[ISI][Medline].

41.   Talon, S, Huchet-Cadiou C, and Léoty C. Inositol 1,4,5-trisphosphate Ca2+ release in rat fast- and slow-twitch skinned muscle fibers. Pflügers Arch 438: 804-816, 1999[ISI][Medline].

42.   Talon, S, Huchet-Cadiou C, and Léoty C. Rapid cooling-induced contractures in rat skinned skeletal muscle fibers originate from sarcoplasmic reticulum Ca2+ release through ryanodine and inositol trisphosphate receptors. Pflügers Arch 441: 108-117, 2000[ISI][Medline].

43.   Taylor, CW, Genazzani AA, and Morris S. Expression of inositol trisphosphate receptors. Cell Calcium 26: 237-251, 1999[ISI][Medline].

44.   Vergara, J, Tsien RY, and Delay M. Inositol 1,4,5-trisphosphate: a possible chemical link in excitation-contraction coupling in muscle. Proc Natl Acad Sci USA 82: 6352-6356, 1985[Abstract/Free Full Text].

45.   Volpe, P, Salviati G, Di Virgilio F, and Pozzan T. Inositol 1,4,5-trisphosphate induces calcium release from sarcoplasmic reticulum of skeletal muscle. Nature 316: 347-349, 1985[Medline].

46.   Wendt, IR, and Stephenson DG. Effects of caffeine on Ca2+-activated force production in skinned cardiac and skeletal muscle fibers of rat. Pflügers Arch 398: 210-216, 1983[ISI][Medline].

47.   Zorzato, F, Fujii J, Otsu K, Phillips M, Green NM, Lai FA, Meissner G, and McLennan DH. Molecular cloning of cDNA encoding human and rabbit forms of the Ca2+ release channel (ryanodine receptor) of skeletal muscle sarcoplasmic reticulum. J Biol Chem 265: 2244-2256, 1990[Abstract/Free Full Text].

Am J Physiol Regul Integr Comp Physiol 282(4):R1164-R1173
0363-6119/02 $5.00 Copyright © 2002 the American Physiological Society


This article has been cited by other articles:


Home page
 Physiol. Rev.Home page
J. K. Foskett, C. White, K.-H. Cheung, and D.-O. D. Mak
Inositol Trisphosphate Receptor Ca2+ Release Channels
Physiol Rev, April 1, 2007; 87(2): 593 - 658.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Talon, S.
Right arrow Articles by Léoty, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Talon, S.
Right arrow