AJP - Regu Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Regul Integr Comp Physiol 280: R1483-R1487, 2001;
0363-6119/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (111)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nagaya, N.
Right arrow Articles by Kangawa, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nagaya, N.
Right arrow Articles by Kangawa, K.
Vol. 280, Issue 5, R1483-R1487, May 2001

Hemodynamic and hormonal effects of human ghrelin in healthy volunteers

Noritoshi Nagaya1, Masayasu Kojima2, Masaaki Uematsu3, Masakazu Yamagishi1, Hiroshi Hosoda2, Hideo Oya1, Yujiro Hayashi4, and Kenji Kangawa2

Departments of 1 Internal Medicine and 2 Biochemistry, National Cardiovascular Center, Osaka 565 - 8565; 3 Department of Internal Medicine, Osaka Seamen's Insurance Hospital, Osaka 552-0021; and 4 Institute for Medical Research and Development, Suntory Limited, Gunma 370-0503, Japan


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

To investigate hemodynamic and hormonal effects of ghrelin, a novel growth hormone (GH)-releasing peptide, we gave six healthy men an intravenous bolus of human ghrelin (10 µg/kg) or placebo and vice versa 1-2 wk apart in a randomized fashion. Ghrelin elicited a marked increase in circulating GH (15-fold). The elevation of GH lasted longer than 60 min after the bolus injection. Injection of ghrelin significantly decreased mean arterial pressure (-12 mmHg, P < 0.05) without a significant change in heart rate (-4 beats/min, P = 0.39). Ghrelin significantly increased cardiac index (+16%, P < 0.05) and stroke volume index (+22%, P < 0.05). We also examined ghrelin receptor [GH secretagogues receptor (GHS-R)] gene expression in the aortas, the left ventricles, and the left atria of rats by RT-PCR. GHS-R mRNA was detectable in the rat aortas, left ventricles, and left atria, suggesting that ghrelin may cause cardiovascular effects through GH-independent mechanisms. In summary, human ghrelin elicited a potent, long-lasting GH release and had beneficial hemodynamic effects via reducing cardiac afterload and increasing cardiac output without an increase in heart rate.

hemodynamics; hormones; vasodilation


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

RECENTLY, GROWTH HORMONE (GH) activity has been proposed to be associated with myocardial growth and cardiac function (1, 6, 20). In addition to the physiological stimulation by hypothalamic GH-releasing hormone (GHRH), the release of GH from the pituitary is stimulated by small synthetic molecules called GH secretagogues (GHS) (5, 13, 16). They act through a GHS receptor (GHS-R), a G protein-coupled receptor (11), for which the ligand was unknown until we successfully isolated an endogenous ligand specific for GHS-R, ghrelin, from the stomach in December 1999 (12). Human ghrelin is a 28-amino-acid peptide containing an n-octanoyl modification at serine-3 and is homologous to rat ghrelin apart from two amino acids. If ghrelin possesses GH-releasing activity in humans, ghrelin may have beneficial effects in patients with chronic heart failure through a GH-dependent mechanism. On the other hand, ghrelin may have direct cardiovascular effects through GH-independent mechanisms because ghrelin peptide and mRNA are detected in a variety of tissues including the heart and blood vessels and because a specific binding for GHS exists not only in the hypothalamus and pituitary but also in the heart (8). However, the effects of ghrelin in humans are totally unknown. Thus, the purpose of this study was to investigate hemodynamic and hormonal effects of intravenous ghrelin in healthy volunteers.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Study subjects. We studied six healthy male hospital staff members, aged 30 ± 1 yr, who weighed 68 ± 5 kg. None of them had any history of cardiovascular, renal, respiratory, hepatic, or metabolic disease, and none were taking any drugs. Physical examination and electrocardiographic and echocardiographic findings were also normal. The study was approved by the ethics committee of the National Cardiovascular Center, and all subjects gave written informed consent.

Preparation of synthetic human ghrelin. Human ghrelin was obtained from the Peptide Institute, Osaka, Japan. The homogeneity of human ghrelin was confirmed by reverse-phase, high-performance liquid chromatography (RP-HPLC) and amino acid analysis. Ghrelin was dissolved in distilled water with 4% D-mannitol and was sterilized by passage through a 0.22-µm filter (Millipore). Ghrelin was stored as 1 ml volumes (each containing 600 µg ghrelin) at -80°C until the time of preparation for administration.

Study protocol. The subjects were studied on 2 separate days (1 day, ghrelin; 1 day, placebo) 1-2 wk apart in a randomized, crossover fashion. This study was performed after the subjects fasted overnight, because plasma ghrelin level has been shown to be altered by food intake (19). A 7.5 French Swan-Ganz catheter (TOO21H-7.5F, Baxter) was positioned in the pulmonary artery through a jugular vein to measure pulmonary arterial pressure and pulmonary capillary wedge pressure. Cardiac output was determined by thermodilution method in triplicate (7). A 22-gauge cannula was inserted into a radial artery for measurement of heart rate and systemic arterial pressure. Another 22-gauge cannula was inserted into a forearm vein for infusion of ghrelin. Ghrelin (10 µg/kg) was dissolved in 5 ml saline. After an equilibration period of 60 min, baseline measurements were performed. Then, 5 ml of ghrelin solution or placebo (0.9% saline) was administered as an intravenous bolus. Hemodynamic measurements were repeatedly performed until 120 min after the injection. Blood sampling was repeated at 15 points (-10, 0, 1, 3, 5, 10, 15, 20, 30, 40, 50, 60, 80, 100, and 120 min after ghrelin injection). Plasma half-life of ghrelin was calculated using WinNonlin library (noncompartmental model, Scientific Consulting).

RIA for plasma ghrelin. RIA for plasma ghrelin was performed as described previously (10). In brief, a polyclonal antibody was raised against the COOH terminus fragment (13-28) of rat ghrelin in a rabbit. A maleimide-activated mariculture keyhole limpet hemocyanin-[Cys]-ghrelin-(13-28) conjugate was used for immunization. [Tyr0]-rat ghrelin (13-28) was radioiodinated by the lactoperoxidase method. A monoiodinated ligand was purified by RP-HPLC on a µBondasphere C18 column (3.9 × 150 mm, Waters, Milford, MA). The tracer was stable for 3 mo and stored at -20°C in 0.1% bovine serum albumin. The RIA incubation mixture consisted of 100 µl of unknown sample, 100 µl of normal rabbit serum, and 200 µl of antiserum at a dilution of 1:10,000. After 12 h incubation at 4°C, 100 µl of 125I-labeled ligand (15,000 cpm) was added to the mixture. After 36 h incubation at 4°C, 100 µl of anti-rabbit goat antibody was added. Free and bound tracers were separated by centrifugation at 3,000 rpm for 30 min after incubation for 24 h at 4°C. After aspiration of supernatant, radioactivity in the pellet was quantified with a gamma counter (ARC-600, Aloka, Tokyo, Japan). The minimum detectable dose of ghrelin was <6 fmol/tube. The antiserum exhibited 100% cross-reactivity with rat or human ghrelin (13-28). No significant cross-reactivity with other peptides was observed. Intraobserver variability of ghrelin measurement was less than 6%, and its interobserver variability was less than 9%.

Other biochemical measurements. Serum GH was measured with an immunoradiometric assay kit (Ab Bead HGH Eiken, Eiken Chemical, Tokyo, Japan). Serum follicle-stimulating hormone (FSH), luteinizing hormone (LH), prolactin (PRL), and thyroid-stimulating hormone (TSH) were measured using immunoradiometric assay kits (SPAC-S FSH, LH, Prolactin, and TSH, Daiichi Radioisotope Laboratories, Tokyo, Japan). Plasma adrenocorticotropin (ACTH) was measured with an immunoradiometric assay (ACTH IRMA Mitsubishi, Mitsubishi Chemical, Tokyo, Japan). Plasma cortisol was measured with a radioimmunoassay kit (Gamma-Coat Cortisol, Date Behring). Serum insulin-like growth factor-1 (IGF-1) was determined by an immunoradiometric assay kit (Somatomedin CII Bayer, Bayer Medical, Tokyo, Japan). Plasma norepinephrine and epinephrine were measured with HPLC. Plasma cAMP and cGMP were determined with specific RIA kits (cAMP assay kit, cGMP assay kit, Yamasa Shoyu, Chiba, Japan).

RT-PCR analysis. mRNA expression of GHS-R, a specific receptor for ghrelin, was examined in the descending aorta, the left ventricle, and the left atrium of male Wistar rats. Total RNA was extracted from the tissues and was converted to cDNA by reverse transcription (RT). PCR was performed for 35 cycles (5 s at 98°C, 10 s at 65°C, and 1 min at 72°C) with specific primers (sense, GAGATCGCTCAGATCAGCCAGTAC and antisense, TAATCCCCAAACTGAGGTTCTGC). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA was amplified as the control.

All animal experiments were conducted in accordance with the principles and procedures outlined in the National Cardiovascular Center Guide for the Care and Use of Laboratory Animals, which adheres strictly to the National Institutes of Health animal experimental guidelines, with the approval of the National Cardiovascular Center Animal Experimental Committee.

Statistical analysis. Data were expressed as means ± SE. Comparisons of the time course of parameters between two groups were made by two-way ANOVA for repeated measures, followed by Newman-Keuls test. A P value < 0.05 was considered statistically significant.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

All study subjects tolerated this study protocol, although ghrelin caused a slight warm feeling and sleepiness in four subjects.

Hormonal response to ghrelin. Plasma ghrelin level increased about 61-fold of baseline value ~1 min after ghrelin injection. The plasma ghrelin level disappeared with half-lives of 10 min (Fig. 1A). Injection of ghrelin elicited a marked increase in circulating GH, with the peak level (15× baseline value) occurring 20 min after administration (Fig. 1B). The elevation of GH level lasted >60 min after the bolus injection. Ghrelin significantly increased circulating levels of PRL, ACTH, and cortisol, whereas it did not significantly alter FSH, LH, or TSH level (Table 1). No significant change in serum IGF-1 was observed throughout the study protocol. Ghrelin significantly increased plasma epinephrine but not norepinephrine. Ghrelin significantly increased plasma cAMP but not plasma cGMP. These hormonal parameters remained unchanged during placebo injection.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 1.   Circulating ghrelin level after a single injection of ghrelin (A). Effects of ghrelin on circulating growth hormone (GH) (B). Data are means ± SE. *P < 0.05 vs. placebo group. The arrow indicates an intravenous injection of ghrelin or placebo.


                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Hormonal responses to administration of ghrelin or placebo

Hemodynamic response to ghrelin. Injection of ghrelin significantly decreased mean arterial pressure to a minimum level (-12 mmHg, P < 0.05; Fig. 2) without a significant change in heart rate (-4 beats/min, P = 0.39). The hypotensive effect of ghrelin lasted for 100 min after the injection. No significant change in mean pulmonary arterial pressure or pulmonary capillary wedge pressure was observed (data not shown). Cardiac index significantly rose to the maximum level 15 min after injection of ghrelin (+16%, P < 0.05) and returned to near preinjection level at 60 min. Stroke volume index also rose to the maximum level 15 min after injection (+22%, P < 0.05). Consequently, ghrelin markedly decreased systemic vascular resistance (-24%, P < 0.05). These hemodynamic parameters remained unchanged after placebo injection.


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 2.   Effects of ghrelin on heart rate (HR), mean arterial pressure (MAP), cardiac index (CI), and stroke volume index (SVI). Data are means ± SE. *P < 0.05 vs. placebo group. The arrow indicates an intravenous injection of ghrelin or placebo.

Detection of GHS-R expression. GHS-R mRNA was detectable by RT-PCR in the rat aorta as well as the left ventricle and left atrium (Fig. 3).


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 3.   Ghrelin receptor (GHS-R) mRNA in the rat aorta and heart detected by RT-PCR. Top bands represent GHS-R mRNA expression. Lower bands represent glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA expression.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

This is the first study to examine hemodynamic and hormonal effects of ghrelin in humans. In the present study, we demonstrated that 1) intravenous injection of ghrelin elicited a potent, long-lasting GH release in healthy volunteers and 2) ghrelin decreased mean arterial pressure and increased cardiac output but did not increase heart rate.

Ghrelin is a novel GH-releasing peptide, isolated from the stomach, that acts through a mechanism independent from that of hypothalamic GHRH (12). The GH-releasing effects of ghrelin are thought to be mediated by specific receptors, GHS-R, mainly present at the pituitary and hypothalamic level. Taken together with the fact that intravenously administered ghrelin induced a potent GH release in humans, the data suggest that this molecule is produced in and secreted from the stomach and circulates in the bloodstream to act on the pituitary. A single injection of ghrelin resulted in a relatively long-lasting elevation of circulating GH, although plasma ghrelin level decayed soon after a single intravenous administration. Replacement therapy with GH has been reported to have beneficial effects on myocardial structure and function in patients with chronic heart failure (6, 20). Thus it may be interesting to investigate whether ghrelin administration is beneficial in patients with heart failure by inducing potent, long-lasting GH release.

Ghrelin also exhibited stimulatory effects on PRL, ACTH, and cortisol secretion, which is consistent with the effects of hexarelin (HEX), a synthetic GH-releasing peptide (14). GHS-R, a specific receptor for ghrelin and HEX, has been shown to exist abundantly in the hypothalamus and pituitary (11). Thus the hormonal effects of ghrelin may be due to direct effects at the pituitary level as well as in the hypothalamus. The stimulatory effect of ghrelin on cortisol secretion seems to be due to its ACTH-releasing property, because the cortisol-releasing activity of HEX is lost in the presence of hypothalamo-pituitary disconnection (17). Ghrelin significantly increased plasma epinephrine, but not norepinephrine, level. Considering the presence of GHS-binding sites in the adrenal (8), the epinephrine-releasing effect of ghrelin may be due to direct effects on the adrenal.

To our knowledge, GHRH, another physiological GH-releasing factor, has no direct cardiovascular effects because the GHRH receptor is restricted to specific tissues including pituitary membranes (15). In contrast, ghrelin peptide and its specific binding sites are detected in a variety of tissues including the heart and blood vessels (8, 10, 12). In the present study, we first demonstrated that ghrelin induced a marked, long-lasting hypotensive effect, although activation of the hypothalamic-pituitary-adrenal (HPA) axis is known to be associated with hypertension. A single injection of ghrelin did not significantly increase circulating IGF-1, which has been shown to cause vasodilation through a direct stimulatory effect on nitric oxide synthesis (3). In addition, we recently found that ghrelin induced hypotension in hypophysectomized rats in which ghrelin could not stimulate the release of either GH or IGF-1 (unpublished data). Furthermore, we showed that the GHS-R gene was abundantly expressed in the rat aorta. Ghrelin injection significantly increased plasma cAMP level in association with decreases in mean arterial pressure. These findings raise the possibility that ghrelin has a direct vasorelaxant effect. Further studies are necessary to elucidate the relationship between ghrelin and the HPA axis. Surprisingly, the hypotensive effect of ghrelin was not associated with an increase in heart rate or plasma norepinephrine. It is interesting to speculate that ghrelin may inhibit activation of the sympathetic nervous system during hypotension, which may be beneficial in treating patients with congestive heart failure. Unlike ghrelin, HEX, a GHS, does not induce a hypotensive effect, although HEX has a positive inotropic effect in humans (2). It is interesting to speculate that different affinities for GHS-R in the vasculature may contribute to the differential vascular effects of ghrelin and HEX.

This study also demonstrated that ghrelin significantly increased cardiac index and stroke volume index. Considering the hypotensive effect of ghrelin, we believe that a decrease in cardiac afterload may be responsible for the increased cardiac index. Alternatively, because GH upregulates sarcoplasmic Ca2+-ATPase and thereby enhances myocardial contractility (18), part of the cardiac effects of ghrelin may be mediated by GH. Interestingly, the GHS-R gene was abundantly expressed in the myocardium. Thus it is possible that ghrelin may have some direct actions on myocardium. It is also possible that increased plasma epinephrine by ghrelin might indirectly increase cardiac index and stroke volume index. Further studies are necessary to examine the potential mechanisms responsible for these cardiovascular effects of ghrelin.

Study limitations. In the present study, hormonal responses to ghrelin were examined after the subjects fasted overnight, because plasma ghrelin level has been shown to be altered by food intake (19). On the other hand, fasting may alter GH responses to ghrelin and contribute to the uncoupling of the GH/IGF-1 axis in study subjects (4, 9). Further studies are necessary to investigate the effects of food intake on GH/IGF-1 responses to ghrelin.

Summary. Human ghrelin elicited a potent, long-lasting GH release and had beneficial hemodynamic effects via reducing cardiac afterload and increasing cardiac output without increasing heart rate. Based on the results of this preliminary study, we believe that the long-term effects of ghrelin in patients with chronic heart failure should be examined in a randomized, large-scale study.

Perspectives

GH supplement has been reported to improve myocardial structure and function in patients with idiopathic dilated cardiomyopathy, a condition in which compensatory cardiac hypertrophy is believed to be deficient (6). Given the potent GH-releasing activity and direct cardiovascular effects of ghrelin, it may be interesting to investigate whether ghrelin administration is beneficial in patients with intractable chronic heart failure.


    ACKNOWLEDGEMENTS

This work was supported by the Promotion of Fundamental Studies in Health Science of the Organization for Pharmaceutical Safety and Research of Japan and a Japan Heart Foundation Research Grant.


    FOOTNOTES

Address for reprint requests and other correspondence: N. Nagaya, Dept. of Internal Medicine, National Cardiovascular Center, 5-7-1 Fujishirodai, Suita, Osaka 565-8565, Japan.

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 25 August 2000; accepted in final form 17 January 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Amato, G, Carella C, Fazio S, La Montagna G, Cittadini A, Sabatini D, Marciano-Mone C, Sacca L, and Bellastella A. Body composition, bone metabolism, heart structure and function in growth hormone deficient adults before and after growth hormone replacement therapy at low doses. J Clin Endocrinol Metab 77: 1671-1676, 1993[Abstract].

2.   Bisi, G, Podio V, Valetto MR, Broglio F, Bertuccio G, Del Rio G, Arvat E, Boghen MF, Deghenghi R, Muccioli G, Ong H, and Ghigo E. Acute cardiovascular and hormonal effects of GH and hexarelin, a synthetic GH-releasing peptide, in humans. J Endocrinol Invest 22: 266-272, 1999[ISI][Medline].

3.   Boger, RH, Skamira C, Bode-Boger SM, Brabant G, Muhlen A, and Frolich J. Nitric oxide may mediate the hemodynamic effects of recombinant growth hormone in patients with acquired growth hormone deficiency: a double-blind, placebo-controlled study. J Clin Invest 98: 2706-2713, 1996[ISI][Medline].

4.   De Marinis, L, Mancini A, Valle D, Izzi D, Bianchi A, Gentilella R, Giampietro A, Desenzani P, and Giustina A. Role of food intake in the modulation of hexarelin-induced growth hormone release in normal human subjects. Horm Metab Res 32: 152-156, 2000[ISI][Medline].

5.   Deghenghi, R, Cananzi MM, Torsello A, Battisti C, Muller EE, and Locatelli V. GH-releasing activity of hexarelin. A new growth hormone releasing peptide, in infants and adult rats. Life Sci 54: 1321-1328, 1994[ISI][Medline].

6.   Fazio, S, Sabatini D, Capaldo B, Vigorito C, Giordano A, Guida R, Pardo F, Biondi B, and Sacca L. A preliminary study of growth hormone in the treatment of dilated cardiomyopathy. N Engl J Med 334: 809-814, 1996[Abstract/Free Full Text].

7.   Ganz, W, Donoso R, Marcus HS, Forrester JS, and Swan HJ. A new technique for measurement of cardiac output by thermodilution in man. Am J Cardiol 27: 392-396, 1971[ISI][Medline].

8.   Ghigo, E, Arvat E, Broglio F, Giordano R, Gianotti L, Muccioli G, Papotti M, Graziani A, Bisi G, Deghenghi R, and Camanni F. Endocrine and nonendocrine activities of growth hormone secretagogues in humans. Horm Res 51: 9-15, 1999.

9.   Heinrichs, C, Colli M, Yanovski JA, Laue L, Gerstl NA, Kramer AD, Uyeda JA, and Baron J. Effects of fasting on the growth plate: systemic and local mechanisms. Endocrinology 138: 5359-5365, 1997[Abstract/Free Full Text].

10.   Hosoda, H, Kojima M, Matsuo H, and Kangawa K. Ghrelin and des-acyl ghrelin: two major forms of rat ghrelin peptide in gastrointestinal tissue. Biochem Biophys Res Commun 279: 909-913, 2000[ISI][Medline].

11.   Howard, AD, Fieghner SD, Cully DF, Arena JP, Liberator PA, and Rosenblum CI. A receptor in pituitary and hypothalamus that functions in growth hormone release. Science 273: 974-977, 1996[Abstract].

12.   Kojima, M, Hosoda H, Date Y, Nakazato M, Matsuo H, and Kangawa K. Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature 402: 656-660, 1999[Medline].

13.   Locatelli, V, and Torsello A. Growth hormone secretagogues: focus on the growth hormone releasing peptides. Pharmacol Res 36: 415-423, 1997[ISI][Medline].

14.   Massoud, AF, Hindmarsh PC, and Brook CGD Hexarelin-induced growth hormone, cortisol, and prolactin release: a dose-response study. J Clin Endocrinol Metab 81: 4338-4341, 1996[Abstract].

15.   Petersenn, S, and Schulte HM. Structure and function of the growth-hormone-releasing hormone receptor. Vitam Horm 59: 35-69, 2000[Medline].

16.   Smith, RG, Cheng K, Schoen WR, Pong SS, Hickey G, and Jacks T. A nonpeptidyl growth hormone secretagogue. Science 260: 1640-1643, 1993[Abstract/Free Full Text].

17.   Smith, RG, Van der Ploeg LH, Howard AD, Feighner SD, Cheng K, Hickey GJ, Wyvratt MJ, Jr, Fisher MH, Nargund RP, and Patchett AA. Peptidomimetic regulation of growth hormone secretion. Endocr Rev 18: 621-645, 1997[Abstract/Free Full Text].

18.   Tajima, M, Weinberg EO, Bartunek J, Jin H, Yang R, Paoni NF, and Lorell BH. Treatment with growth hormone enhances contractile reserve and intracellular calcium transients in myocytes from rats with postinfarction heart failure. Circulation 99: 127-134, 1999[Abstract/Free Full Text].

19.   Tschop, M, Smiley DL, and Heiman ML. Ghrelin induces adiposity in rodents. Nature 407: 908-913, 2000[Medline].

20.   Volterrani, M, Desenzani P, Lorusso R, d'Aloia A, Manelli F, and Giustina A. Hemodynamic effects of intravenous growth hormone in congestive heart failure. Lancet 349: 1067-1068, 1997[ISI][Medline].


Am J Physiol Regul Integr Comp Physiol 280(5):R1483-R1487
0363-6119/01 $5.00 Copyright © 2001 the American Physiological Society



This article has been cited by other articles:


Home page
J Clin PharmacolHome page
K. C. Lasseter, L. Shaughnessy, D. Cummings, J. C. Pezzullo, W. Wargin, R. Gagnon, J. Oliva, and G. Kosutic
Ghrelin Agonist (TZP-101): Safety, Pharmacokinetics and Pharmacodynamic Evaluation in Healthy Volunteers: A Phase I, First-in-Human Study
J. Clin. Pharmacol., February 1, 2008; 48(2): 193 - 202.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
E. T. Vestergaard, N. H. Andersen, T. K. Hansen, L. M. Rasmussen, N. Moller, K. E. Sorensen, E. Sloth, and J. O. L. Jorgensen
Cardiovascular effects of intravenous ghrelin infusion in healthy young men
Am J Physiol Heart Circ Physiol, November 1, 2007; 293(5): H3020 - H3026.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
J.-N. Ma, H. H. Schiffer, A. E. Knapp, J. Wang, K. K. Wong, E. A. Currier, M. Owens, N. R. Nash, L. R. Gardell, M. R. Brann, et al.
Identification of the Atypical L-Type Ca2+ Channel Blocker Diltiazem and Its Metabolites As Ghrelin Receptor Agonists
Mol. Pharmacol., August 1, 2007; 72(2): 380 - 386.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
N. Tawadros, L.A. Salamonsen, E. Dimitriadis, and C. Chen
Facilitation of decidualization by locally produced ghrelin in the human endometrium
Mol. Hum. Reprod., July 1, 2007; 13(7): 483 - 489.
[Abstract] [Full Text] [PDF]


Home page
RadiologyHome page
A. Arepally, B. P. Barnett, E. Montgomery, and T. H. Patel
Catheter-directed Gastric Artery Chemical Embolization for Modulation of Systemic Ghrelin Levels in a Porcine Model: Initial Experience
Radiology, July 1, 2007; 244(1): 138 - 143.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
E. T. Vestergaard, T. K. Hansen, L. C. Gormsen, P. Jakobsen, N. Moller, J. S. Christiansen, and J. O. L. Jorgensen
Constant intravenous ghrelin infusion in healthy young men: clinical pharmacokinetics and metabolic effects
Am J Physiol Endocrinol Metab, June 1, 2007; 292(6): E1829 - E1836.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
A. Baessler, M. Fischer, B. Mayer, M. Koehler, S. Wiedmann, K. Stark, A. Doering, J. Erdmann, G. Riegger, H. Schunkert, et al.
Epistatic interaction between haplotypes of the ghrelin ligand and receptor genes influence susceptibility to myocardial infarction and coronary artery disease
Hum. Mol. Genet., April 15, 2007; 16(8): 887 - 899.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
M. Iantorno, H. Chen, J.-a Kim, M. Tesauro, D. Lauro, C. Cardillo, and M. J. Quon
Ghrelin has novel vascular actions that mimic PI 3-kinase-dependent actions of insulin to stimulate production of NO from endothelial cells
Am J Physiol Endocrinol Metab, March 1, 2007; 292(3): E756 - E764.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
R. R. Kraemer and V. D. Castracane
Exercise and Humoral Mediators of Peripheral Energy Balance: Ghrelin and Adiponectin
Experimental Biology and Medicine, February 1, 2007; 232(2): 184 - 194.
[Abstract] [Full Text] [PDF]


Home page
J ANIM SCIHome page
A. E. Wertz-Lutz, T. J. Knight, R. H. Pritchard, J. A. Daniel, J. A. Clapper, A. J. Smart, A. Trenkle, and D. C. Beitz
Circulating ghrelin concentrations fluctuate relative to nutritional status and influence feeding behavior in cattle
J Anim Sci, December 1, 2006; 84(12): 3285 - 3300.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
J Tack, I Depoortere, R Bisschops, C Delporte, B Coulie, A Meulemans, J Janssens, and T Peeters
Influence of ghrelin on interdigestive gastrointestinal motility in humans
Gut, March 1, 2006; 55(3): 327 - 333.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
M. J. Kleinz, J. J. Maguire, J. N. Skepper, and A. P. Davenport
Functional and immunocytochemical evidence for a role of ghrelin and des-octanoyl ghrelin in the regulation of vascular tone in man
Cardiovasc Res, January 1, 2006; 69(1): 227 - 235.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
A. P. Davenport, T. I. Bonner, S. M. Foord, A. J. Harmar, R. R. Neubig, J.-P. Pin, M. Spedding, M. Kojima, and K. Kangawa
International Union of Pharmacology. LVI. Ghrelin Receptor Nomenclature, Distribution, and Function
Pharmacol. Rev., December 1, 2005; 57(4): 541 - 546.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
C D R Murray, N M Martin, M Patterson, S A Taylor, M A Ghatei, M A Kamm, C Johnston, S R Bloom, and A V Emmanuel
Ghrelin enhances gastric emptying in diabetic gastroparesis: a double blind, placebo controlled, crossover study
Gut, December 1, 2005; 54(12): 1693 - 1698.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
R. Wu, W. Dong, M. Zhou, X. Cui, H. Hank Simms, and P. Wang
Ghrelin improves tissue perfusion in severe sepsis via downregulation of endothelin-1
Cardiovasc Res, November 1, 2005; 68(2): 318 - 326.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
X.-B. Xu, J.-J. Pang, J.-M. Cao, C. Ni, R.-K. Xu, X.-Z. Peng, X.-X. Yu, S. Guo, M.-C. Chen, and C. Chen
GH-releasing peptides improve cardiac dysfunction and cachexia and suppress stress-related hormones and cardiomyocyte apoptosis in rats with heart failure
Am J Physiol Heart Circ Physiol, October 1, 2005; 289(4): H1643 - H1651.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
G. P. Zaloga
Ghrelin, Diet, and Pulmonary Function
Chest, September 1, 2005; 128(3): 1084 - 1086.
[Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
K. Wynne, K. Giannitsopoulou, C. J. Small, M. Patterson, G. Frost, M. A. Ghatei, E. A. Brown, S. R. Bloom, and P. Choi
Subcutaneous Ghrelin Enhances Acute Food Intake in Malnourished Patients Who Receive Maintenance Peritoneal Dialysis: A Randomized, Placebo-Controlled Trial
J. Am. Soc. Nephrol., July 1, 2005; 16(7): 2111 - 2118.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
M. Kojima and K. Kangawa
Ghrelin: Structure and Function
Physiol Rev, April 1, 2005; 85(2): 495 - 522.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
N. Nagaya, J. Moriya, Y. Yasumura, M. Uematsu, F. Ono, W. Shimizu, K. Ueno, M. Kitakaze, K. Miyatake, and K. Kangawa
Effects of Ghrelin Administration on Left Ventricular Function, Exercise Capacity, and Muscle Wasting in Patients With Chronic Heart Failure
Circulation, December 14, 2004; 110(24): 3674 - 3679.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
T. Henriques-Coelho, J. Correia-Pinto, R. Roncon-Albuquerque Jr, M. J. Baptista, A. P. Lourenco, S. M. Oliveira, A. Brandao-Nogueira, A. Teles, J. M. Fortunato, and A. F. Leite-Moreira
Endogenous production of ghrelin and beneficial effects of its exogenous administration in monocrotaline-induced pulmonary hypertension
Am J Physiol Heart Circ Physiol, December 1, 2004; 287(6): H2885 - H2890.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
C. J. Pemberton, H. Tokola, Z. Bagi, A. Koller, J. Pontinen, A. Ola, O. Vuolteenaho, I. Szokodi, and H. Ruskoaho
Ghrelin induces vasoconstriction in the rat coronary vasculature without altering cardiac peptide secretion
Am J Physiol Heart Circ Physiol, October 1, 2004; 287(4): H1522 - H1529.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
R. Wu, M. Zhou, X. Cui, H. H. Simms, and P. Wang
Upregulation of cardiovascular ghrelin receptor occurs in the hyperdynamic phase of sepsis
Am J Physiol Heart Circ Physiol, September 1, 2004; 287(3): H1296 - H1302.
[Abstract] [Full Text] [PDF]


Home page
Arch SurgHome page
E. Lin, N. Gletsu, K. Fugate, D. McClusky, L. H. Gu, J.-L. Zhu, B. J. Ramshaw, D. A. Papanicolaou, T. R. Ziegler, and C. D. Smith
The Effects of Gastric Surgery on Systemic Ghrelin Levels in the Morbidly Obese
Arch Surg, July 1, 2004; 139(7): 780 - 784.
[Abstract] [Full Text] [PDF]


Home page
J ANIM SCIHome page
B. E. Salfen, J. A. Carroll, D. H. Keisler, and T. A. Strauch
Effects of exogenous ghrelin on feed intake, weight gain, behavior, and endocrine responses in weanling pigs
J Anim Sci, July 1, 2004; 82(7): 1957 - 1966.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
A. J. van der Lely, M. Tschop, M. L. Heiman, and E. Ghigo
Biological, Physiological, Pathophysiological, and Pharmacological Aspects of Ghrelin
Endocr. Rev., June 1, 2004; 25(3): 426 - 457.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
M. J Iglesias, R. Pineiro, M. Blanco, R. Gallego, C. Dieguez, O. Gualillo, J. R Gonzalez-Juanatey, and F. Lago
Growth hormone releasing peptide (ghrelin) is synthesized and secreted by cardiomyocytes
Cardiovasc Res, June 1, 2004; 62(3): 481 - 488.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J.-J. Pang, R.-K. Xu, X.-B. Xu, J.-M. Cao, C. Ni, W.-L. Zhu, K. Asotra, M.-C. Chen, and C. Chen
Hexarelin protects rat cardiomyocytes from angiotensin II-induced apoptosis in vitro
Am J Physiol Heart Circ Physiol, March 1, 2004; 286(3): H1063 - H1069.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
S. M. Poykko, E. Kellokoski, S. Horkko, H. Kauma, Y. A. Kesaniemi, and O. Ukkola
Low Plasma Ghrelin Is Associated With Insulin Resistance, Hypertension, and the Prevalence of Type 2 Diabetes
Diabetes, October 1, 2003; 52(10): 2546 - 2553.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
W. A. Cupples
Peptides that regulate food intake
Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2003; 284(6): R1370 - R1374.
[Full Text] [PDF]


Home page
Arch SurgHome page
D. E. Cummings and M. H. Shannon
Roles for Ghrelin in the Regulation of Appetite and Body Weight
Arch Surg, April 1, 2003; 138(4): 389 - 396.
[Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J. J. Kuo, O. B. Jones, and J. E. Hall
Chronic cardiovascular and renal actions of leptin during hyperinsulinemia
Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2003; 284(4): R1037 - R1042.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Biol.Home page
G. Baldanzi, N. Filigheddu, S. Cutrupi, F. Catapano, S. Bonissoni, A. Fubini, D. Malan, G. Baj, R. Granata, F. Broglio, et al.
Ghrelin and des-acyl ghrelin inhibit cell death in cardiomyocytes and endothelial cells through ERK1/2 and PI 3-kinase/AKT
J. Cell Biol., December 23, 2002; 159(6): 1029 - 1037.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M.L. Barreiro, F. Gaytan, J.E. Caminos, L. Pinilla, F.F. Casanueva, E. Aguilar, C. Dieguez, and M. Tena-Sempere
Cellular Location and Hormonal Regulation of Ghrelin Expression in Rat Testis
Biol Reprod, December 1, 2002; 67(6): 1768 - 1776.
[Abstract] [Full Text] [PDF]